circad | circRNAs associated with diseases

hsa_circ_001569
Gene	ABCC1	Organism	Human
Genome Locus	chr16:16101672-16162159:+	Build	hg19
Disease	Colorectal Cancer	ICD-10	#N/A (C19)
DBLink	Link to database	PMID	27058418
Experimental Method
Sample Type	Tissue and cell lines	Comparison	30 CRC tissue samples and matched non-tumor normal tissue samples
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCCCCTGAACATTCTCCCCAT Reverse GAAAGCACTTGGTGAAGTCGG	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Xie, H, Ren, X, Xin, S, Lan, X, Lu, G, Lin, Y, Yang, S, Zeng, Z, Liao, W, Ding, YQ, Liang, L (2016). Emerging roles of circRNA_001569 targeting miR-145 in the proliferation and invasion of colorectal cancer. Oncotarget, 7, 18:26680-91.